shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(NCRNA00085-shRNA-Seq3)(CAT#: AdV-SI1113WQ)
This product is a NCRNA00085-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The NCRNA00085 gene encode the sperm protein potentially involved sperm-egg fusion. The expression of NCRNA00085-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | NCRNA00085-shRNA-Seq3 |
| Related Target/Protein | NCRNA00085 |
| Region | CDS |
| TargetSeq | CAAGCTTGAAGAGTGTGAGGA |
| NCBI RefSeq | NM_207324 |
| Alternative Names | LET7EH; SPACA6P; LINC00085; SPACA6 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Infertility |