shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(NSMAF-shRNA-Seq1)(CAT#: AdV-SI3409WQ)
This product is a NSMAF-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The NSMAF gene encodes a WD-repeat protein that binds the cytoplasmic sphingomyelinase activation domain of the 55kD tumor necrosis factor receptor and may play a role in regulating TNF-induced cellular responses such as inflammation. The expression of NSMAF-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | NSMAF-shRNA-Seq1 |
Related Target/Protein | NSMAF |
Region | 3UTR |
TargetSeq | GCCATTAGTTGCTATTCTCTT |
NCBI RefSeq | NM_003580 |
Alternative Names | FAN; GRAMD5 |
Titer | >1*10^10 GC/mL |
Related Diseases | Inflammation |