shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(OR1J4-shRNA-Seq4)(CAT#: AdV-SI3332WQ)

This product is a OR1J4-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The OR1J4 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR1J4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert OR1J4-shRNA-Seq4
Related Target/Protein OR1J4
Region CDS
TargetSeq GCACAATTATTGGACTGTATT
NCBI RefSeq XM_294533
Alternative Names OR9-21; HTPCRX01; HSHTPCRX01
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 26219
Uniprot ID Q8NGS1

Related Products