shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Osgin1-shRNA-Seq1)(CAT#: AdV-SI4003WQ)
This product is a Osgin1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Osgin1 gene encodes an oxidative stress response protein that regulates cell death. The expression of Osgin1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Osgin1-shRNA-Seq1 |
| Related Target/Protein | Osgin1 |
| Region | CDS |
| TargetSeq | GACTTGGTCATAGACCCAGAT |
| NCBI RefSeq | NM_027950 |
| Alternative Names | BDGI; OKL38 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Inflammatory |
