shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(PCMTD1-shRNA-Seq1)(CAT#: AdV-SI1077WQ)

This product is a PCMTD1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. PCMTD1 is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include protein-L-isoaspartate (D-aspartate) O-methyltransferase activity. The expression of PCMTD1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert PCMTD1-shRNA-Seq1
Related Target/Protein PCMTD1
Region CDS
TargetSeq GCATTGAAACTTCAACCAGGA
NCBI RefSeq NM_052937
Titer >1*10^10 GC/mL
Related Diseases Glaucoma, Lung cancer
Target Gene
Gene ID 115294
Uniprot ID Q96MG8

Related Products