shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Peo1-shRNA-Seq2)(CAT#: AdV-SI3541WQ)

This product is a Peo1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The gene Peo1 encodes a hexameric DNA helicase which unwinds short stretches of double-stranded DNA in the 5' to 3' direction and, along with mitochondrial single-stranded DNA binding protein and mtDNA polymerase gamma, is thought to play a key role in mtDNA replication. The expression of Peo1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Peo1-shRNA-Seq2
Related Target/Protein Peo1
Region CDS
TargetSeq GGTGTCTATCACAACCTATTT
NCBI RefSeq NM_153796
Alternative Names PEO; TWNK; SCA8; ATXN8; IOSCA; PEOA3; SANDO; TWINL; MTDPS7; PRLTS5; C10orf2
Titer >1*10^10 GC/mL
Related Diseases Infantile onset spinocerebellar ataxia (IOSCA), Progressive external ophthalmoplegia (PEO), Several mitochondrial depletion syndromes
Target Gene
Gene ID 56652
Uniprot ID Q96RR1

Related Products