shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(PIGW-shRNA-Seq2)(CAT#: AdV-SI1142WQ)
This product is a PIGW-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by PIGW gene is an inositol acyltransferase that acylates the inositol ring of phosphatidylinositol. Defects in this gene are a cause of the age-dependent epileptic encephalopathy West syndrome as well as a syndrome exhibiting hyperphosphatasia and cognitive disability (HPMRS5). The expression of PIGW-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | PIGW-shRNA-Seq2 |
| Related Target/Protein | PIGW |
| Region | 3UTR |
| TargetSeq | GCAACAGTGTTAACCATATTT |
| NCBI RefSeq | NM_178517 |
| Alternative Names | Gwt1; HPMRS5 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Hyperphosphatasia and mental retardation syndrome |