shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(PLEKHM1-shRNA-Seq1)(CAT#: AdV-SI1432WQ)

This product is a PLEKHM1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by PLEKHM1 gene is essential for bone resorption, and may play a critical role in vesicular transport in the osteoclast. The expression of PLEKHM1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert PLEKHM1-shRNA-Seq1
Related Target/Protein PLEKHM1
Region 3UTR
TargetSeq GCCAGTGCTTTCAGATGCATT
NCBI RefSeq NM_014798
Alternative Names B2; AP162; OPTA3; OPTB6
Titer >1*10^10 GC/mL
Related Diseases Autosomal recessive osteopetrosis type 6 (OPTB6)
Target Gene
Gene ID 9842
Uniprot ID Q9Y4G2

Related Products