shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Prb1-shRNA-Seq1)(CAT#: AdV-SI4014WQ)

This product is a Prb1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Prb1 gene encodes a member of the heterogeneous family of basic, proline-rich, human salivary glycoproteins. The encoded preproprotein undergoes proteolytic processing to generate one or more mature peptides before secretion from the parotid glands. The expression of Prb1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Prb1-shRNA-Seq1
Related Target/Protein Prb1
Region CDS
TargetSeq CGAAGACTCAAATTCTCAGCT
NCBI RefSeq NM_198669
Alternative Names PM; PMF; PMS; PRB1L; PRB1M
Titer >1*10^10 GC/mL
Target Gene
Gene ID 5542
Uniprot ID P04280

Related Products