shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(PRELID2-shRNA-Seq3)(CAT#: AdV-SI1300WQ)
This product is a PRELID2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of PRELID2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | PRELID2-shRNA-Seq3 |
| Related Target/Protein | PRELID2 |
| Region | 3UTR |
| TargetSeq | CCAATGCGTTATGATGATTAA |
| NCBI RefSeq | NM_138492 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Chronic Hepatitis B infection |
