shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Prlhr-shRNA-Seq1)(CAT#: AdV-SI4025WQ)
This product is a Prlhr-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Prlhr gene is a 7-transmembrane domain receptor for prolactin-releasing hormone that is highly expressed in anterior pituitary. The expression of Prlhr-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Prlhr-shRNA-Seq1 |
Related Target/Protein | Prlhr |
Region | 3UTR |
TargetSeq | GATCTTATTCCCAGCACCAAA |
NCBI RefSeq | NM_201615 |
Alternative Names | GR3; GPR10; PrRPR |
Titer | >1*10^10 GC/mL |