shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Pus7-shRNA-Seq4)(CAT#: AdV-SI3486WQ)

This product is a Pus7-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Pus7 gene encodes pseudouridylate synthase that catalyzes pseudouridylation of RNAs. The expression of Pus7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Pus7-shRNA-Seq4
Related Target/Protein Pus7
Region 3UTR
TargetSeq CAAGTCCTGAGGATCCTAATT
NCBI RefSeq NM_178403
Alternative Names IDDABS
Titer >1*10^10 GC/mL
Target Gene
Gene ID 54517
Uniprot ID Q96PZ0

Related Products