shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Reep4-shRNA-Seq1)(CAT#: AdV-SI4027WQ)

This product is a Reep4-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Reep4 gene probably acts by clearing the endoplasmic reticulum membrane from metaphase chromosomes. The expression of Reep4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Reep4-shRNA-Seq1
Related Target/Protein Reep4
Region 3UTR
TargetSeq GCACAGGGAGACATTCACTAT
NCBI RefSeq NM_180588
Alternative Names PP432; Yip2c; C8orf20
Titer >1*10^10 GC/mL
Target Gene
Gene ID 80346
Uniprot ID Q9H6H4

Related Products