shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(RNPS1-shRNA-Seq4)(CAT#: AdV-SI1054WQ)
This product is a RNPS1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The RNPS1 gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. The expression of RNPS1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | RNPS1-shRNA-Seq4 |
Related Target/Protein | RNPS1 |
Region | CDS |
TargetSeq | CAGCTCCAACTCCTCCCGATA |
NCBI RefSeq | NM_006711 |
Alternative Names | E5.1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Neuro-developmental disorders |