shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(RPRM-shRNA-Seq2)(CAT#: AdV-SI1413WQ)
This product is a RPRM-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The RPRM gene may be involved in the regulation of p53-dependent G2 arrest of the cell cycle. The expression of RPRM-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | RPRM-shRNA-Seq2 |
Related Target/Protein | RPRM |
Region | 3UTR |
TargetSeq | GAACTTTGGAAGCTGCTACTT |
NCBI RefSeq | NM_019845 |
Alternative Names | REPRIMO |
Titer | >1*10^10 GC/mL |
Related Diseases | Lung carcinoma |