shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(RTBDN-shRNA-Seq2)(CAT#: AdV-SI1376WQ)
This product is a RTBDN-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by RTBDN gene is preferentially expressed in the retina and may play a role in binding retinoids and other carotenoids as it shares homology with riboflavin binding proteins. The expression of RTBDN-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | RTBDN-shRNA-Seq2 |
| Related Target/Protein | RTBDN |
| Region | CDS |
| TargetSeq | GAATGCGAATCCTTCCTGGAA |
| NCBI RefSeq | NM_031429 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Eye disease |