shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(SAMD8-shRNA-Seq3)(CAT#: AdV-SI1444WQ)
This product is a SAMD8-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. SAMD8 is an endoplasmic reticulum (ER) transferase that has no sphingomyelin synthase activity but can convert phosphatidylethanolamine (PE) and ceramide to ceramide phosphoethanolamine (CPE) albeit with low product yield. The expression of SAMD8-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | SAMD8-shRNA-Seq3 |
| Related Target/Protein | SAMD8 |
| Region | 3UTR |
| TargetSeq | CGTGACTGAGAAGCATTGGAA |
| NCBI RefSeq | NM_144660 |
| Alternative Names | SMSr; HEL-177 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Bilateral Hearing Impairment |