shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(SESN3-shRNA-Seq2)(CAT#: AdV-SI3414WQ)

This product is a SESN3-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The SESN3 gene encodes a member of the sestrin family of stress-induced proteins and plays a role in lipid storage in obesity. The expression of SESN3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert SESN3-shRNA-Seq2
Related Target/Protein SESN3
Region CDS
TargetSeq GCTGAACTTCTTTATGCTCTT
NCBI RefSeq NM_144665
Alternative Names SEST3
Titer >1*10^10 GC/mL
Related Diseases Obesity
Target Gene
Gene ID 143686
Uniprot ID P58005

Related Products