shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(SESN3-shRNA-Seq2)(CAT#: AdV-SI3414WQ)
This product is a SESN3-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The SESN3 gene encodes a member of the sestrin family of stress-induced proteins and plays a role in lipid storage in obesity. The expression of SESN3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | SESN3-shRNA-Seq2 |
Related Target/Protein | SESN3 |
Region | CDS |
TargetSeq | GCTGAACTTCTTTATGCTCTT |
NCBI RefSeq | NM_144665 |
Alternative Names | SEST3 |
Titer | >1*10^10 GC/mL |
Related Diseases | Obesity |