shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(SPAM1-shRNA-Seq2)(CAT#: AdV-SI3207WQ)
This product is a SPAM1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The SPAM1 gene encodes a GPI-anchored enzyme located on the human sperm surface and inner acrosomal membrane. This multifunctional protein is a hyaluronidase that enables sperm to penetrate through the hyaluronic acid-rich cumulus cell layer surrounding the oocyte, a receptor that plays a role in hyaluronic acid induced cell signaling, and a receptor that is involved in sperm-zona pellucida adhesion. The expression of SPAM1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | SPAM1-shRNA-Seq2 |
| Related Target/Protein | SPAM1 |
| Region | CDS |
| TargetSeq | GCAAGGAGTGTGTATAAGGAA |
| NCBI RefSeq | NM_003117 |
| Alternative Names | HYA1; PH20; HYAL1; HYAL3; HYAL5; PH-20; SPAG15; HEL-S-96n |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Infertility |