shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(SPATA19-shRNA-Seq1)(CAT#: AdV-SI1166WQ)

This product is a SPATA19-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The SPATA19 may have a role in spermiogenesis. The expression of SPATA19-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert SPATA19-shRNA-Seq1
Related Target/Protein SPATA19
Region CDS
TargetSeq CGGACATTGACGTTGTGGAAA
NCBI RefSeq NM_174927
Alternative Names CT132; SPAS1; spergen1
Titer >1*10^10 GC/mL
Related Diseases Spermiogenesis
Target Gene
Gene ID 219938
Uniprot ID Q7Z5L4

Related Products