shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(SPIRE2-shRNA-Seq2)(CAT#: AdV-SI1264WQ)

This product is a SPIRE2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The SPIRE2 acts as an actin nucleation factor, remains associated with the slow-growing pointed end of the new filament and is involved in intracellular vesicle transport along actin fibers, providing a novel link between actin cytoskeleton dynamics and intracellular transport. The expression of SPIRE2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert SPIRE2-shRNA-Seq2
Related Target/Protein SPIRE2
Region 3UTR
TargetSeq CATGATGAAATGTTGTCTCTA
NCBI RefSeq NM_032451
Alternative Names Spir-2
Titer >1*10^10 GC/mL
Target Gene
Gene ID 84501
Uniprot ID Q8WWL2

Related Products