shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Tcte1-shRNA-Seq2)(CAT#: AdV-SI3598WQ)
This product is a Tcte1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Tcte1 gene may play a role in the assembly of N-DRC and be required for sperm motility. The expression of Tcte1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Tcte1-shRNA-Seq2 |
Related Target/Protein | Tcte1 |
Region | CDS |
TargetSeq | CTTCTCCTCACCCACTAACAA |
NCBI RefSeq | NM_013688 |
Alternative Names | DRC5; D6S46; FAP155 |
Titer | >1*10^10 GC/mL |
Related Diseases | Infertility |