shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(TDRD7-shRNA-Seq1)(CAT#: AdV-SI1348WQ)

This product is a TDRD7-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by TDRD7 gene belongs to the Tudor family of proteins. This protein contains conserved Tudor domains and LOTUS domains. It is a component of RNA granules, which function in RNA processing. Mutations in this gene have been associated with cataract formation in mouse and human. The expression of TDRD7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert TDRD7-shRNA-Seq1
Related Target/Protein TDRD7
Region 3UTR
TargetSeq CCTCTGAAACCTTGACAACTA
NCBI RefSeq NM_014290
Alternative Names TRAP; CATC4; PCTAIRE2BP
Titer >1*10^10 GC/mL
Related Diseases Congenital cataract and nonobstructive azoospermia
Target Gene
Gene ID 23424
Uniprot ID Q8NHU6

Related Products