shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Tha1-shRNA-Seq1)(CAT#: AdV-SI3939WQ)

This product is a Tha1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Tha1 gene has L-allo-threonine aldolase activity. The expression of Tha1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Tha1-shRNA-Seq1
Related Target/Protein Tha1
Region 3UTR
TargetSeq CTGGAGGATGGTGACATCATT
NCBI RefSeq NM_027919
Alternative Names GLY1; 1300017K07Rik
Titer >1*10^10 GC/mL
Target Gene
Gene ID 71776
Uniprot ID Q9DBC9

Related Products