shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(TMEM177-shRNA-Seq3)(CAT#: AdV-SI3506WQ)
This product is a TMEM177-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The preotien encoded by TMEM177 gene plays a role in the early steps of cytochrome c oxidase subunit II (MT-CO2/COX2) maturation. The expression of TMEM177-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | TMEM177-shRNA-Seq3 |
Related Target/Protein | TMEM177 |
Region | 3UTR |
TargetSeq | GCTATGAATCTGAGCCTTTGT |
NCBI RefSeq | NM_030577 |
Titer | >1*10^10 GC/mL |