shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(TRABD-shRNA-Seq2)(CAT#: AdV-SI1251WQ)
This product is a TRABD-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The TRABD encodes metalloprotease that acts as a negative regulator of the Wnt signaling pathway by mediating the cleavage of the 8 N-terminal residues of a subset of Wnt proteins. The expression of TRABD-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | TRABD-shRNA-Seq2 |
Related Target/Protein | TRABD |
Region | 3UTR |
TargetSeq | CCACCCAAATAAAGGATTATT |
NCBI RefSeq | NM_025204 |
Alternative Names | LP6054; PP2447 |
Titer | >1*10^10 GC/mL |
Related Diseases | Graves' Disease |