shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(TTC21A-shRNA-Seq2)(CAT#: AdV-SI1291WQ)
This product is a TTC21A-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. Bi-allelic Mutations in TTC21A Induce Asthenoteratospermia in Humans and Mice. The expression of TTC21A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | TTC21A-shRNA-Seq2 |
Related Target/Protein | TTC21A |
Region | CDS |
TargetSeq | GCAATATTGATGCCTGCCAAA |
NCBI RefSeq | NM_145755 |
Alternative Names | STI2; SPGF37; IFT139A |
Titer | >1*10^10 GC/mL |
Related Diseases | Asthenoteratospermia |