shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Ush1g-shRNA-Seq1)(CAT#: AdV-SI3979WQ)
This product is a Ush1g-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Ush1g gene encodes a protein that contains three ankyrin domains, a class I PDZ-binding motif and a sterile alpha motif. This protein plays a role in the development and maintenance of the auditory and visual systems and functions in the cohesion of hair bundles formed by inner ear sensory cells. Mutations in this gene are associated with Usher syndrome type 1G (USH1G). The expression of Ush1g-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Ush1g-shRNA-Seq1 |
Related Target/Protein | Ush1g |
Region | 3UTR |
TargetSeq | GCTCTGAATTACAAGAGGATT |
NCBI RefSeq | NM_176847 |
Alternative Names | SANS; ANKS4A |
Titer | >1*10^10 GC/mL |
Related Diseases | Usher syndrome type 1C |