shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(VARS2-shRNA-Seq2)(CAT#: AdV-SI3234WQ)

This product is a VARS2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The VARS2 encodes a mitochondrial aminoacyl-tRNA synthetase, which catalyzes the attachment of valine to tRNA(Val) for mitochondrial translation. Mutations in this gene cause combined oxidative phosphorylation deficiency-20, and are also associated with early-onset mitochondrial encephalopathies. The expression of VARS2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert VARS2-shRNA-Seq2
Related Target/Protein VARS2
Region 3UTR
TargetSeq GTCAGAGACTATGTGGTCCAT
NCBI RefSeq NM_020442
Alternative Names VALRS; VARSL; VARS2L; COXPD20
Titer >1*10^10 GC/mL
Related Diseases oxidative phosphorylation deficiency-20
Target Gene
Gene ID 57176
Uniprot ID Q5ST30

Related Products