shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Vipar-shRNA-Seq1)(CAT#: AdV-SI4032WQ)
This product is a Vipar-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Vipar gene encodes a protein involved in the sorting of lysosomal proteins. Mutations in this gene are associated with ARCS2 (arthrogryposis, renal dysfunction, and cholestasis-2). The expression of Vipar-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Vipar-shRNA-Seq1 |
| Related Target/Protein | Vipar |
| Region | 3UTR |
| TargetSeq | CCAGCCTTTGAGCACATGTAT |
| NCBI RefSeq | NM_134044 |
| Alternative Names | SPE39; VIPAR; SPE-39; VPS16B; hSPE-39; C14orf133; VIPAS39 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Arthrogryposis, renal dysfunction, and cholestasis-2 |