shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(WDR62-shRNA-Seq2)(CAT#: AdV-SI3800WQ)
This product is a WDR62-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The WDR62 gene is proposed to play a role in cerebral cortical development. Mutations in this gene have been associated with microencephaly, cortical malformations, and cognitive disability. The expression of WDR62-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | WDR62-shRNA-Seq2 |
Related Target/Protein | WDR62 |
Region | CDS |
TargetSeq | CAACACCATTCGCTTCTGGAA |
NCBI RefSeq | NM_173636 |
Alternative Names | MCPH2; C19orf14 |
Titer | >1*10^10 GC/mL |
Related Diseases | Microencephaly, cortical malformations, and cognitive disability |