shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(YPEL3-shRNA-Seq3)(CAT#: AdV-SI1160WQ)
This product is a YPEL3-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The YPEL3 gene is involved in proliferation and apoptosis in myeloid precursor cells. The expression of YPEL3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | YPEL3-shRNA-Seq3 |
| Related Target/Protein | YPEL3 |
| Region | CDS |
| TargetSeq | GAAGTACATCATTGAACTCAA |
| NCBI RefSeq | NM_031477 |
| Alternative Names | Ypel3; Suap |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Mammary tumor |