shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(ZDHHC19-shRNA-Seq3)(CAT#: AdV-SI1082WQ)
This product is a ZDHHC19-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. ZDHHC19 is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include protein-cysteine S-palmitoyltransferase activity. The expression of ZDHHC19-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | ZDHHC19-shRNA-Seq3 |
| Related Target/Protein | ZDHHC19 |
| Region | CDS |
| TargetSeq | CCTTTCCTGTTATCACAGGCT |
| NCBI RefSeq | NM_144637 |
| Alternative Names | DHHC19 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Liver cancer |