shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(ZNF280C-shRNA-Seq2)(CAT#: AdV-SI1446WQ)

This product is a ZNF280C-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The ZNF280C gene encodes a member of the zinc finger domain-containing protein family. The expression of ZNF280C-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert ZNF280C-shRNA-Seq2
Related Target/Protein ZNF280C
Region CDS
TargetSeq GAGCCTTGCTTTGAAGAACAT
NCBI RefSeq NM_017666
Alternative Names ZPET; SUHW3; ZNF633
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55609
Uniprot ID Q8ND82

Related Products