shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(AARSD1-shRNA-Seq1)(CAT#: AdV-SI0844WQ)
This product is a AARSD1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The AARSD1 gene functions in trans to edit the amino acid moiety from incorrectly charged tRNA(Ala). The expression of AARSD1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | AARSD1-shRNA-Seq1 |
| Related Target/Protein | AARSD1 |
| Region | CDS |
| TargetSeq | GCAGTTGCTGACCATCTATTT |
| NCBI RefSeq | NM_025267 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer |
