shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Agpat4-shRNA-Seq4)(CAT#: AdV-SI2620WQ)
This product is a Agpat4-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Agpat4 gene encodes a member of the 1-acylglycerol-3-phosphate O-acyltransferase family and this integral membrane protein converts lysophosphatidic acid to phosphatidic acid. The expression of Agpat4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Agpat4-shRNA-Seq4 |
| Related Target/Protein | Agpat4 |
| Region | CDS |
| TargetSeq | GCTGGGAGTCTTAAATGGAAA |
| NCBI RefSeq | NM_026644 |
| Alternative Names | 1-AGPAT4; dJ473J16.2; LPAAT-delta |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Cancer |