shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(APBA3-shRNA-Seq2)(CAT#: AdV-SI0813WQ)
This product is a APBA3-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by APBA3 gene is a member of the X11 protein family. It is an adapter protein that interacts with the Alzheimer's disease amyloid precursor protein. The expression of APBA3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | APBA3-shRNA-Seq2 |
Related Target/Protein | APBA3 |
Region | CDS |
TargetSeq | GTCGGATGGAACTTGATGAGT |
NCBI RefSeq | NM_004886 |
Alternative Names | X11L2; mint3; MGC:15815 |
Titer | >1*10^10 GC/mL |
Related Diseases | Alzheimer's disease |