shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(BC027231-shRNA-Seq5)(CAT#: AdV-SI2837WQ)

This product is a BC027231-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The BC027231 gene may play a role in cortex development as part of the Notch signaling pathway. The expression of BC027231-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert BC027231-shRNA-Seq5
Related Target/Protein BC027231
Region 3UTR
TargetSeq CCTTGTGTAAGCTAATCACAT
NCBI RefSeq NM_145972
Alternative Names Nepro
Titer >1*10^10 GC/mL
Related Diseases Neuronal differentiation and embryo development
Target Gene
Gene ID 212547
Uniprot ID Q8R2U2

Related Products