shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(BC049762-shRNA-Seq1)(CAT#: AdV-SI3080WQ)
This product is a BC049762-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of BC049762-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | BC049762-shRNA-Seq1 |
| Related Target/Protein | BC049762 |
| Region | CDS |
| TargetSeq | CACTTTCTGTGTACCCTCAAA |
| NCBI RefSeq | NM_177567 |
| Alternative Names | 4930503F14 |
| Titer | >1*10^10 GC/mL |
| Target Gene | |
|---|---|
| Gene ID | 193286 |
| Uniprot ID | A0A338P6D5 |
