shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(BOD1-shRNA-Seq3)(CAT#: AdV-SI0687WQ)

This product is a BOD1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The BOD1 gene is required for proper chromosome biorientation through the detection or correction of syntelic attachments in mitotic spindles. The expression of BOD1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert BOD1-shRNA-Seq3
Related Target/Protein BOD1
Region 3UTR
TargetSeq CGAAACATGAAATCCTAGAAT
NCBI RefSeq NM_138369
Alternative Names FAM44B
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 91272
Uniprot ID Q96IK1

Related Products