shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C030018G13Rik-shRNA-Seq1)(CAT#: AdV-SI3157WQ)
This product is a C030018G13Rik-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by C030018G13Rik gene is component of the NALCN sodium channel complex, required for channel regulation. The expression of C030018G13Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | C030018G13Rik-shRNA-Seq1 |
| Related Target/Protein | C030018G13Rik |
| Region | CDS |
| TargetSeq | GCTCTCCAATCAACAGTCAGA |
| NCBI RefSeq | NM_175510 |
| Alternative Names | UNC-80; Unc80; C230061B10Rik |
| Titer | >1*10^10 GC/mL |