shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C10orf27-shRNA-Seq1)(CAT#: AdV-SI0980WQ)
This product is a C10orf27-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The C10orf27 gene encodes a protein that regulates thymic epithelial cell proliferation and thymus size. It has been identified as a ligand for the class I human leukocyte antigen (HLA-I) in thymus. The expression of C10orf27-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | C10orf27-shRNA-Seq1 |
| Related Target/Protein | C10orf27 |
| Region | CDS |
| TargetSeq | GAGTACATTGGAGAAGCTCAA |
| NCBI RefSeq | NM_152710 |
| Alternative Names | SPATIAL; TBATA |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Multiple sclerosis (MS) |