shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C11orf52-shRNA-Seq2)(CAT#: AdV-SI0706WQ)

This product is a C11orf52-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of C11orf52-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C11orf52-shRNA-Seq2
Related Target/Protein C11orf52
Region CDS
TargetSeq CAACTTACATTATGCTGACAT
NCBI RefSeq NM_080659
Titer >1*10^10 GC/mL
Related Diseases DNA methylation
Target Gene
Gene ID 91894
Uniprot ID Q96A22

Related Products