shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C12orf32-shRNA-Seq2)(CAT#: AdV-SI0900WQ)
This product is a C12orf32-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The C12orf32 gene plays a role in DNA damage response (DDR) signaling upon genotoxic stresses such as ionizing radiation (IR) during the S phase. The expression of C12orf32-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | C12orf32-shRNA-Seq2 |
| Related Target/Protein | C12orf32 |
| Region | CDS |
| TargetSeq | CCCGAGGACAAGTATGGAATA |
| NCBI RefSeq | NM_031465 |
| Alternative Names | RHINO; RHNO1; HKMT1188 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | DNA damage response (DDR) |
