shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C17orf77-shRNA-Seq2)(CAT#: AdV-SI0704WQ)

This product is a C17orf77-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of C17orf77-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C17orf77-shRNA-Seq2
Related Target/Protein C17orf77
Region CDS
TargetSeq GTCTCTTGCTCACTTCCTGTT
NCBI RefSeq NM_152460
Titer >1*10^10 GC/mL
Target Gene
Gene ID 146723
Uniprot ID Q96MU5

Related Products