shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C1orf126-shRNA-Seq1)(CAT#: AdV-SI2942WQ)

This product is a C1orf126-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of C1orf126-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert C1orf126-shRNA-Seq1
Related Target/Protein C1orf126
Region CDS
TargetSeq GAGTTGTAACATGCGGGCATT
NCBI RefSeq NM_182534
Alternative Names C1orf126
Titer >1*10^10 GC/mL
Target Gene
Gene ID 200197
Uniprot ID B3KW75

Related Products