shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C1qtnf3-shRNA-Seq3)(CAT#: AdV-SI2723WQ)

This product is a C1qtnf3-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of C1qtnf3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert C1qtnf3-shRNA-Seq3
Related Target/Protein C1qtnf3
Region 3UTR
TargetSeq CCCACTTACTAGACTCTACAT
NCBI RefSeq NM_030888
Alternative Names CORS; CORCS; CTRP3; CORS26; C1ATNF3; CORS-26
Titer >1*10^10 GC/mL
Target Gene
Gene ID 114899
Uniprot ID Q9BXJ4

Related Products