shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C20orf43-shRNA-Seq2B)(CAT#: AdV-SI2852WQ)

This product is a C20orf43-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The C20orf43 gene may be required for ATR pathway signaling upon DNA damage and has a positive activity during DNA replication and function to facilitate fork pausing at replication fork barriers like the rDNA. The expression of C20orf43-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert C20orf43-shRNA-Seq2B
Related Target/Protein C20orf43
Region CDS
TargetSeq GATGATGTCATCGTGCTCAAT
NCBI RefSeq NM_016407
Alternative Names CDAO5; RTFDC1; HSPC164; RTF2; SHUJUN-3
Titer >1*10^10 GC/mL
Target Gene
Gene ID 51507
Uniprot ID Q9BY42

Related Products