shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C21orf2-shRNA-Seq2)(CAT#: AdV-SI0854WQ)

Datasheet

This product is a C21orf2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The C21orf2 gene is down-regulated in Down syndrome (DS) brain, which may represent mitochondrial dysfunction in DS patients. The expression of C21orf2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C21orf2-shRNA-Seq2
Related Target/Protein C21orf2
Region CDS
TargetSeq GATATCTCCATTTGCCAGGAG
NCBI RefSeq NM_004928
Alternative Names RDMS; SMDAX; LRRC76; YF5/A2; CFAP410
Titer >1*10^10 GC/mL
Related Diseases Amyotrophic lateral sclerosis, Down syndrome (DS) brain
Target Gene
Gene ID 755
Uniprot ID O43822

Related Products

Recombinant adenovirus, pU6-(Mouse EB3), Overexpression (CAT#:AdV-GTOH0037WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(GAGE4-shRNA-Seq2) (CAT#:AdV-SI1450WQ) Recombinant adenovirus, pU6-(Human sirt3), Overexpression (CAT#:AdV-GTOH0662WQ) Recombinant adenovirus, pU6-(Human TRABD2B(TIKI2)), Overexpression (CAT#:AdV-GTOH0637WQ) Recombinant adenovirus, pU6-(Human BACE1( K275R)), Overexpression (CAT#:AdV-GTOH0010WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(GOLGA8E-shRNA-Seq2) (CAT#:AdV-SI0378WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Gvin1-shRNA-Seq5) (CAT#:AdV-SI3457WQ) Recombinant adenovirus, pU6-(Human EcR 3'UTR), Overexpression (CAT#:AdV-GTOH0279WQ)