shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C21orf2-shRNA-Seq2)(CAT#: AdV-SI0854WQ)
This product is a C21orf2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The C21orf2 gene is down-regulated in Down syndrome (DS) brain, which may represent mitochondrial dysfunction in DS patients. The expression of C21orf2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | C21orf2-shRNA-Seq2 |
| Related Target/Protein | C21orf2 |
| Region | CDS |
| TargetSeq | GATATCTCCATTTGCCAGGAG |
| NCBI RefSeq | NM_004928 |
| Alternative Names | RDMS; SMDAX; LRRC76; YF5/A2; CFAP410 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Amyotrophic lateral sclerosis, Down syndrome (DS) brain |
