shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C22orf33-shRNA-Seq3)(CAT#: AdV-SI0712WQ)

This product is a C22orf33-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of C22orf33-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C22orf33-shRNA-Seq3
Related Target/Protein C22orf33
Region CDS
TargetSeq CAGAAAGCACTGGAAGAGAAA
NCBI RefSeq NM_178552
Alternative Names EAN57; TEX33; cE81G9.2
Titer >1*10^10 GC/mL
Target Gene
Gene ID 339669
Uniprot ID O43247

Related Products